Every living organism has its own genetic "blueprint": the source code for how it grows, functions and reproduces. This ...
Aksesuar Design announces the Quiet Kitchen System, a field-tested performance standard and delivery process for modern ...
Oscar nominees Ryan Tudhope, Nicolas Chevallier, Keith Dawson, and Robert Harrington reveal how real racing, broadcast ...
Want to create cinematic storyboards or visually consistent AI characters across scenes? In this video, we dive deep into ...
Abstract: Protein sequence generation models aim to produce valid protein candidates on demand, however, controllably generating protein sequences with specified target functionalities remains ...
error:[vg::Constructor] Variant/reference sequence mismatch: TGTGGACCAACCACGGAATCTGGAGAAGAGCGTGACCACGCAGTAGGTAGAGAGGTGGAA vs pos: 1554005 ...
Oat (Avena sativa) grain is a traditional human food that is rich in dietary fiber and contributes to improved human health. Interest in the crop has surged in recent years owing to its use as the ...
ABSTRACT: Papillomaviruses have the ability to induce infected squamous epithelial cells to form tumors, some of which can progress to malignancies. They are circular double-stranded DNA viruses with ...
ABSTRACT: Papillomaviruses have the ability to induce infected squamous epithelial cells to form tumors, some of which can progress to malignancies. They are circular double-stranded DNA viruses with ...
Thank you for providing such an efficient and accurate basecalling tool for Nanopore sequencing. I am currently studying RNA modifications in viral genomes using direct RNA sequencing, and I plan to ...
This study presents a valuable advance for the analysis of gene expression variation at the level of individual cells by introducing a novel reference-free framework that can detect splicing, fusion, ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results